Ed Trice: Evolution might be a good explanation of how to change something that has been set in motion, but I don't believe you can rewind where we are today back to the beginning using the reverse process. Too many things have to happen "in parallel" and evolution is a serial process.For example, let's look at our uni-cellular friend, the Euglena.
One cell, as mentioned, but look at the complexity involved in trying to decompartmentalize the thing.
It has one of those "tail-thingees" on the end that serves as its means of locomotion. Not too impressed by it?
Well consider this. It has a stator. And a rotor. And it can achieve well over 100,000 rpm and reverse direction without having to go "into neutral" like our own analog transmissions. In fact, no man-made machine has been able to duplicate such a high RPM reversal at the same order of magnitude as our little euglena dude.
OK, still not impressed? Consider this:
In order to "build" a euglena, you have to construct a great many protein chains, tell them how to fold, and fold them all in the correct order, that is also a function of time. That is, somehow in building it, the protein folding mechanism that will build the round part of the shaft through which the flagella will eventually spring out of must communicate that "it is done" so the next portions can begin. Not only that, the operations that can be done in a parallelizeable way begin that way, and seem to converge on their time-based solution with uncanny precision.
So, the shaft is built, the rotor is formed, the stator, the tail is built, and the organism construction begins from the inside out.
How was this real-time, 3D blueprint constructed? Using just 4 pieces of information, the A,C,T, and G components of the DNA molecule!
Billions of "lines of code", such as
ATTCCCCGCGACGACATCATCATCAGACGACAGAAAAGCAGCAGCATATATATT-
TTCATCATCATCCCCCCAACCACCC....
...are what make this thing build.
So what are the "odds" that such a complex DNA sequence could occur "by chance" as other people say?
Let's forget that there are 4 pieces of information per token. Let's turn it into a coin flip, 2 pieces of information.
What are the odds you can get heads 10 times in a row? Well, there are 2x2x2x2x2x2x2x2x2x2 = 2048 different possible states, from heads,heads,heads,heads,heads,heads,heads,heads,heads,-
heads to tails,tails,tails,tails,tails,tails,tails,tails,tails,-
tails with a great deal of intermix in between.
So, while it remains true that the odds of any flip will always be 50:50 for any next result, the odds of getting a series of runs becomes very unlikely rather quickly.
For 32 consecutive flips of either all heads or all tails, you're talking 4 billion flips would produce it once.
Now, for DNA to fold proteins properly and make a living organism, you are not talking about 2 raised to the power of 32 (which is "only" 4 billion) you are talking about 4 raised to the power of a few billion.
There is not enough time in the universe, at 15 billion years times 365 days per year time 86,400 seconds in a day for a single-celled life form to be created by chance. In fact, you could hardly build the rotor or stator with a random DNA molecule that would take 15 billion years.
There is noooooo way you are going to explain the ORIGIN of complex life forms by rewinding evolution to Day 0 and saying that "chance" created the initial concoction!
Kibitzing
